Journal of Inorganic Materials ›› 2023, Vol. 38 ›› Issue (7): 830-838.DOI: 10.15541/jim20220662
• RESEARCH LETTER • Previous Articles Next Articles
WU Wei1,2(
), BAKHET Shahd2, ASANTE Naomi Addai2, KAREEM Shefiu2, KOMBO Omar Ramadhan3, LI Binbin2, DAI Honglian1,2(
)
Received:2022-11-05
Revised:2022-12-18
Published:2023-03-20
Online:2023-03-20
Contact:
DAI Honglian, professor. E-mail: daihonglian@whut.edu.cnAbout author:WU Wei (1998-), male, Master. E-mail: 2625276216@qq.com
Supported by:CLC Number:
WU Wei, BAKHET Shahd, ASANTE Naomi Addai, KAREEM Shefiu, KOMBO Omar Ramadhan, LI Binbin, DAI Honglian. In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation[J]. Journal of Inorganic Materials, 2023, 38(7): 830-838.
| Gene | Primer sequence |
|---|---|
| VEGF | AGGAGTACCCCGACGAGATAGA CACATCTGCTGTGCTGTAGGAA |
| FGF | ACAGGAGCGACCAGCACATT TTGGTGTCTGCGAGCCGTAT |
| COL I | CACTGCAAGAACAGCGTAGC AAGTTCCGGTGTGACTCGTG |
| OPN | ACACTTTCACTCCAATCGTCCCTAC GGACTCCTTAGACTCACCGCTCTT |
Table 1 Primer sequences used in RT-qPCR
| Gene | Primer sequence |
|---|---|
| VEGF | AGGAGTACCCCGACGAGATAGA CACATCTGCTGTGCTGTAGGAA |
| FGF | ACAGGAGCGACCAGCACATT TTGGTGTCTGCGAGCCGTAT |
| COL I | CACTGCAAGAACAGCGTAGC AAGTTCCGGTGTGACTCGTG |
| OPN | ACACTTTCACTCCAATCGTCCCTAC GGACTCCTTAGACTCACCGCTCTT |
Fig. 2 SEM images of different microsphere composites with insets showing their corresponding particle size distributions (a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP
Fig. 5 Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay (a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p < 0.01; **: p < 0.005; ***: p < 0.0002; Colorful figures are available on website
| [1] |
NARITA K, KOBAYASHI E, SATO TJMT. Sintering behavior and mechanical properties of magnesium/β-tricalcium phosphate composites sintered by spark plasma sintering. Materials Transactions, 2016, 57(9):1620.
DOI URL |
| [2] | CHUTHATHIP M, AHMAD-FAUZI M N, YANNY-MARLIANA B I, et al. Effect of magnesium oxide on physical and biological properties in β-tricalcium phosphate ceramic. Journal of Physics Conference Series, 2018, 1082(1):012026. |
| [3] |
BASU S, BASU B. Doped biphasic calcium phosphate: synthesis and structure. Journal of Asian Ceramic Societies, 2019, 7(3):265.
DOI |
| [4] |
GHIȚULICĂ C D, CUCURUZ A, VOICU G, et al. Ceramics based on calcium phosphates substituted with magnesium ions for bone regeneration. International Journal of Applied Ceramic Technology, 2020, 17(1):342.
DOI URL |
| [5] | MAJI K, DASGUPTA S. Effect of β-tricalcium phosphate nanoparticles additions on the properties of gelatin-chitosan scaffolds. Bioceramics Development & Applications, 2017, 7(2):1000103. |
| [6] |
MURAKAMI S, MIYAJI H, NISHIDA E, et al. Dose effects of beta-tricalcium phosphate nanoparticles on biocompatibility and bone conductive ability of three-dimensional collagen scaffolds. Dental Materials Journal, 2017, 36(5):573.
DOI PMID |
| [7] | FANG Z Z. Sintering of advanced materials. Cambridge: Elsevier, 2010: 33- 85. |
| [8] | KAUR I, ELLIS L J, ROMER I, et al. Dispersion of nanomaterials in aqueous media: towards protocol optimization. Journal of Visualized Experiments, 2017, 130: e56074. |
| [9] |
XUE W, DAHLQUIST K, BANERJEE A, et al. Synthesis and characterization of tricalcium phosphate with Zn and Mg based dopants. Journal of Materials Science: Materials in Medicine, 2008, 19(7):2669.
DOI URL |
| [10] |
GUO X, LONG Y, LI W, et al. Osteogenic effects of magnesium substitution in nano-structured β-tricalcium phosphate produced by microwave synthesis. Journal of Materials Science, 2019, 54(16):11197.
DOI |
| [11] |
ELIAZ N, METOKI N J M. Calcium phosphate bioceramics: a review of their history, structure, properties, coating technologies and biomedical applications. Materials, 2017, 10(4):334.
DOI URL |
| [12] |
RAO R R, ROOPA H N, KANNAN T S. Solid state synthesis and thermal stability of HAP and HAP-β-TCP composite ceramic powders. Journal of Materials Science: Materials in Medicine, 1997, 8(8):511.
DOI URL |
| [13] |
RUIZ-AGUILAR C, OLIVARES-PINTO U, AGUILAR-REYES E A, et al. Characterization of β-tricalcium phosphate powders synthesized by Sol-Gel and mechanosynthesis. Boletín de la Sociedad Española de Cerámica y Vidrio, 2018, 57(5):213.
DOI URL |
| [14] |
ANDO J. Tricalcium phosphate and its variation. Bulletin of the Chemical Society of Japan, 1958, 31(2):196.
DOI URL |
| [15] | OLSSON M. Chemical stability of grain boundariesinβ-tricalcium phosphate ceramics: β-TCP as bone substitute material. Department of Chemistry-Ångström, 2012, 42586904. |
| [16] | SGLAVO VM, FRASNELLI M. Effect of Mg2+ doping on beta- alpha phase transition in tricalcium phosphate (TCP) bioceramics. Acta Biomaterialia, 2016, 33: 283. |
| [17] |
MA Y, DAI H, HUANG X, et al. 3D printing of bioglass-reinforced β-TCP porous bioceramic scaffolds. Journal of Materials Science, 2019, 54(14):10437.
DOI |
| [18] | GALLO M, SANTONI B L G, DOUILLARD T, et al. Effect of grain orientation and magnesium doping on β-tricalcium phosphate resorption behavior. Acta Biomaterialia, 2019, 89: 391. |
| [19] |
TAVARES D D S, CASTRO L D O, SOARES G D D A, et al. Synthesis and cytotoxicity evaluation of granular magnesium substituted β-tricalcium phosphate. Journal of Applied Oral Science, 2013, 21(1):37.
DOI URL |
| [20] |
LEE D, SFEIR C, KUMTA P N J M S, et al. Novel in-situ synthesis and characterization of nanostructured magnesium substituted β-tricalcium phosphate (β-TCMP). Materials Science, 2009, 29(1):69.
DOI URL |
| [21] |
MARCHI J, DANTAS A, GREIL P, et al. Influence of Mg-substitution on the physicochemical properties of calcium phosphate powders. Materials Research Bulletin, 2007, 42(6):1040.
DOI URL |
| [22] |
RYU H-S, HONG KS, LEE J-K, et al. Magnesia-doped HA/β-TCP ceramics and evaluation of their biocompatibility. Biomaterials, 2004, 25(3):393.
DOI URL |
| [23] |
ZHANG X, JIANG F, GROTH T, et al. Preparation, characterization and mechanical performance of dense β-TCP ceramics with/ without magnesium substitution. Journal of Materials Science: Materials in Medicine, 2008, 19(9):3063.
DOI URL |
| [24] |
ONUMA K, IIJIMA M J C. Nanoparticles in β-tricalcium phosphate substrate enhance modulation of structure and composition of an octacalcium phosphate grown layer. CrystEngComm, 2017, 19(44):6660.
DOI URL |
| [25] |
SADER M S, LEGEROS R Z, SOARES G A. Human osteoblasts adhesion and proliferation on magnesium-substituted tricalcium phosphate dense tablets. Journal of Materials Science: Materials in Medicine, 2009, 20(2):521.
DOI URL |
| [26] |
LIN L C, CHANG S J, KUO S M, et al. Preparation and evaluation of β-TCP/polylactide microspheres as osteogenesis materials. Journal of Applied Polymer Science, 2008, 108(5):3210.
DOI URL |
| [27] | YUAN Z, WEI P, HUANG Y, et al. Injectable PLGA microspheres with tunable magnesium ion release for promoting bone regeneration. Acta Biomaterialia. 2019, 85: 294. |
| [28] | WANG J, XU J, HOPKINS C, et al. Biodegradable magnesium ased implants in orthopedics: a general review and perspectives. Advanced Science, 2020, 7(8):201902443. |
| [29] |
LIN S, YANG G, JIANG F, et al. Bone regeneration: a magnesiumnriched 3D culture system that mimics the bone development microenvironment for vascularized bone regeneration. Advanced Science, 2019, 6(12):1900209.
DOI URL |
| [30] | PAN C, SUN X, XU G, et al. The effects of β-TCP on mechanical properties, corrosion behavior and biocompatibility of beta- TCP/Zn-Mg composites. Materials Science & Engineering C, 2020, 108: 110397. |
| [31] |
ZHANG H, SHEN Y, XIONG Y, et al. Microstructural, mechanical properties and strengthening mechanism of DLP produced β-tricalcium phosphate scaffolds by incorporation of MgO/ZnO/58S bioglass. Ceramics International, 2021, 47(18):25863.
DOI URL |
| [32] |
ZHANG J. TANG L, QI H, et al. Dual function of magnesium in bone biomineralization, Advanced Healthcare Materials, 2019, 8(21):1901030.
DOI URL |
| [33] | LIN X, GE J, WEI D, et al. Surface degradation-enabled osseointegrative, angiogenic and antiinfective properties of magnesium- modified acrylic bone cement. Journal of Orthopaedic Translation. 2019, 17: 121. |
| [34] |
HE F, TIAN Y, FANG X, et al. Porous calcium phosphate composite bioceramic beads. Ceramics International, 2018, 44(11):13430.
DOI URL |
| [35] | HO V H, TRIPATHI G, GWON J, et al. Novel TOCNF reinforced injectable alginate/β-tricalcium phosphate microspheres for bone regeneration. Materials & Design, 2020, 194: 108892. |
| [36] |
MURAKAMI M, NGUYEN L T, HATANAKA K, et al. FGF-dependent regulation of VEGF receptor 2 expression in mice. The Journal of Clinical Investigation, 2011, 121(7):2668.
DOI URL |
| [37] |
OLIVARES-NAVARRETE R, HYZY S L, GITTENS R A, et al. Rough titanium alloys regulate osteoblast production of angiogenic factors. The Spine Journal, 2013, 13(11):1563.
DOI URL |
| [38] |
MATKAR P N, ARIYAGUNARAJAH R, LEONG-POI H, et al. Friends turned foes: angiogenic growth factors beyond angiogenesis. Biomolecules, 2017, 7(4):74.
DOI URL |
| [39] |
CHIM S M, TICKNER J, CHOW S T, et al. Angiogenic factors in bone local environment. Cytokine Growth Factor Reviews, 2013, 24(3):297.
DOI URL |
| [40] |
TAN A W, LIAU L L, CHUA K H, et al. Enhanced in vitro angiogenic behaviour of human umbilical vein endothelial cells on thermally oxidized TiO2 nanofibrous surfaces. Scientific Reports, 2016, 6(1):21828
DOI |
| [41] |
PRZYBYLSKI M. A review of the current research on the role of bFGF and VEGF in angiogenesis. Journal of Wound Care, 2009, 18(12):516.
PMID |
| [42] | CHEN Y, OU Y, DONG J, et al. Osteopontin promotes collagen I synthesis in hepatic stellate cells by miRNA-129-5p inhibition. Experimental Cell Research, 2017, 363(1):343. |
| [43] | BHASKAR B, OWEN R, BAHMAEE H, et al. Composite porous scaffold of PEG/PLA support improved bone matrix deposition in vitro compared to PLA-only scaffolds, Journal of Biomedical Research Part A, 2018, 106(5):1334. |
| [1] | LI Chengyu, DING Ziyou, HAN Yingchao. In vitro Antibacterial and Osteogenic Properties of Manganese Doped Nano Hydroxyapatite [J]. Journal of Inorganic Materials, 2024, 39(3): 313-320. |
| [2] | LIU Yanyan, XIE Xi, LIU Zengqian, ZHANG Zhefeng. Metal Matrix Composites Reinforced by MAX Phase Ceramics: Fabrication, Properties and Bioinspired Designs [J]. Journal of Inorganic Materials, 2024, 39(2): 145-152. |
| [3] | CHEN Mengjie, WANG Qianqian, WU Chengtie, HUANG Jian. Predicting the Degradability of Bioceramics through a DFT-based Descriptor [J]. Journal of Inorganic Materials, 2024, 39(10): 1175-1181. |
| [4] | ZHENG Jiaqian, LU Xiao, LU Yajie, WANG Yingjun, WANG Zhen, LU Jianxi. Functional Bioadaptability in Medical Bioceramics: Biological Mechanism and Application [J]. Journal of Inorganic Materials, 2024, 39(1): 1-16. |
| [5] | SHI Zhe, LIU Weiye, ZHAI Dong, XIE Jianjun, ZHU Yufang. Akermanite Scaffolds for Bone Tissue Engineering: 3D Printing Using Polymer Precursor and Scaffold Properties [J]. Journal of Inorganic Materials, 2023, 38(7): 763-770. |
| [6] | YUAN Jingkun, XIONG Shufeng, CHEN Zhangwei. Research Trends and Challenges of Additive Manufacturing of Polymer-derived Ceramics [J]. Journal of Inorganic Materials, 2023, 38(5): 477-488. |
| [7] | LUO Shuwen, MA Mingsheng, LIU Feng, LIU Zhifu. Corrosion Behavior and Mechanism of LTCC Materials in Ca-B-Si System [J]. Journal of Inorganic Materials, 2023, 38(5): 553-560. |
| [8] | WU Junlin, DING Jiyang, HUANG Xinyou, ZHU Danyang, HUANG Dong, DAI Zhengfa, YANG Wenqin, JIANG Xingfen, ZHOU Jianrong, SUN Zhijia, LI Jiang. Fabrication and Microstructure of Gd2O2S:Tb Scintillation Ceramics from Water-bath Synthesized Nano-powders: Influence of H2SO4/Gd2O3 Molar Ratio [J]. Journal of Inorganic Materials, 2023, 38(4): 452-460. |
| [9] | LIU Yan, ZHANG Keying, LI Tianyu, ZHOU Bo, LIU Xuejian, HUANG Zhengren. Electric-field Assisted Joining Technology for the Ceramics Materials: Current Status and Development Trend [J]. Journal of Inorganic Materials, 2023, 38(2): 113-124. |
| [10] | SUN Jingwei, WANG Honglei, SUN Chuhan, ZHOU Xingui, JI Xiaoyu. Effects of Carbon Sources on Structure and Properties of TaC Ceramic Powder Prepared by Polymer Derived Ceramics [J]. Journal of Inorganic Materials, 2023, 38(2): 184-192. |
| [11] | JIN Xihai, DONG Manjiang, KAN Yanmei, LIANG Bo, DONG Shaoming. Fabrication of Transparent AlON by Gel Casting and Pressureless Sintering [J]. Journal of Inorganic Materials, 2023, 38(2): 193-198. |
| [12] | KANG Wenshuo, GUO Xiaojie, ZOU Kai, ZHAO Xiangyong, ZHOU Zhiyong, LIANG Ruihong. Enhanced Resistivity Induced by the Second Phase with Layered Structure in BiFeO3-BaTiO3 Ceramics [J]. Journal of Inorganic Materials, 2023, 38(12): 1420-1426. |
| [13] | LI Haiyan, KUANG Fenghua, WU Haolong, LIU Xiaogen, BAO Yiwang, WAN Detian. Temperature Dependence of Residual Tensile Stresses and Its Influences on Crack Propagation Behaviour [J]. Journal of Inorganic Materials, 2023, 38(11): 1265-1270. |
| [14] | HUANG Yihua, HUANG Zhengren, SHA Wenhao, ZHOU Yabin, TAN Zhouxi, ZHANG Mingkang. Thick SiC Green Bodies: Degreasing Analysis and Pressureless High Density Sintering [J]. Journal of Inorganic Materials, 2023, 38(10): 1163-1168. |
| [15] | WU Songze, ZHOU Yang, LI Runfeng, LIU Xiaoqian, LI Cuiwei, HUANG Zhenying. Reaction Sintered Porous Ceramics Using Iron Tailings: Preparation and Properties [J]. Journal of Inorganic Materials, 2023, 38(10): 1193-1199. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||