In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation

doi:10.15541/jim20220662

Abstract

Abstract:

Beta tricalcium phosphate (β-TCP) ceramic substituted materials have attracted a large amount of attention in the last decades because of their chemical similarity with bone inorganic components, good biocompatibility, and osteoconductivity. Such materials can be used for bone replacement and bone formation in various forms, such as nanoparticles, scaffolds and microspheres. In this study, five different microsphere materials of tricalcium phosphate/trimagnesium phosphate (TMP) (TCP, 25% TMP, 50% TMP, 75% TMP, and TMP) composites were prepared and characterized. With the increase of TMP content in the composite microspheres, the cumulative concentration of Mg²⁺and Ca²⁺released from the microspheres increased, indicating that TMP can regulate the degradation rate of the composite microspheres. The osteoblast precursor cell line (MC3T3-E1 cells) and human umbilical vein endothelial cells (HUVECs) were used as models to evaluate the biocompatibility, angiogenesis and osteogenesis of the composite microspheres. The results showed that compared with TCP, TMP and 75% TMP group, 25% TMP and 50% TMP composite microspheres had better cell compatibility and had a certain proliferative effect on HUVECs. Therefore, composite microspheres of 25% TMP and 50% TMP have more significant positive effects on angiogenesis and osteogenesis.

Key words: β-TCP, TMP, bone defect, ceramics, microsphere

CLC Number:

TB321
R318

WU Wei, BAKHET Shahd, ASANTE Naomi Addai, KAREEM Shefiu, KOMBO Omar Ramadhan, LI Binbin, DAI Honglian. In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation[J]. Journal of Inorganic Materials, 2023, 38(7): 830-838.

Figures/Tables 11

Table 1 Primer sequences used in RT-qPCR

Gene	Primer sequence
VEGF	AGGAGTACCCCGACGAGATAGA CACATCTGCTGTGCTGTAGGAA
FGF	ACAGGAGCGACCAGCACATT TTGGTGTCTGCGAGCCGTAT
COL I	CACTGCAAGAACAGCGTAGC AAGTTCCGGTGTGACTCGTG
OPN	ACACTTTCACTCCAATCGTCCCTAC GGACTCCTTAGACTCACCGCTCTT

Fig. 1 XRD patterns of prepared TCP/TMP composite materials

Fig. 2 SEM images of different microsphere composites with insets showing their corresponding particle size distributions (a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP

Fig. 3 TG/DTA/DTG curves of microspheres prepared by water in oil emulsion cross-linking method (a) TCP; (b) 25%TMP; (c) 50%TMP; (d) 75%TMP; (e) TMP

Fig. 4 Released Ca2+and Mg2+ concentrations from materials immersed in tris-HCl solution

Fig. 5 Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay (a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p < 0.01; **: p < 0.005; ***: p < 0.0002; Colorful figures are available on website

Fig. 6 ALP activity and ARS staining of MC3T3-E1 cells cultured with microspheres extract compared with the control on the 7th and 14th day

Fig. 7 (a) VEGF and (b) FGF of HUVECs cultured with microspheres extracts on the 1st and 3rd day

Fig. 8 (a) COLI and (b) OPN genes expression of MC3T3-E1 which cultured with microspheres extract compared to the control on the 3rd and 7th day

Fig. S1 SEM images of different microsphere composites with Bars at 200 μm (up row) and 10 μm (down row)

Fig.S2 XRD patterns of TMP (a) and β-TCP (b)

References 43

[1]	NARITA K, KOBAYASHI E, SATO TJMT. Sintering behavior and mechanical properties of magnesium/β-tricalcium phosphate composites sintered by spark plasma sintering. Materials Transactions, 2016, 57(9):1620. DOI URL
[2]	CHUTHATHIP M, AHMAD-FAUZI M N, YANNY-MARLIANA B I, et al. Effect of magnesium oxide on physical and biological properties in β-tricalcium phosphate ceramic. Journal of Physics Conference Series, 2018, 1082(1):012026.
[3]	BASU S, BASU B. Doped biphasic calcium phosphate: synthesis and structure. Journal of Asian Ceramic Societies, 2019, 7(3):265. DOI
[4]	GHIȚULICĂ C D, CUCURUZ A, VOICU G, et al. Ceramics based on calcium phosphates substituted with magnesium ions for bone regeneration. International Journal of Applied Ceramic Technology, 2020, 17(1):342. DOI URL
[5]	MAJI K, DASGUPTA S. Effect of β-tricalcium phosphate nanoparticles additions on the properties of gelatin-chitosan scaffolds. Bioceramics Development & Applications, 2017, 7(2):1000103.
[6]	MURAKAMI S, MIYAJI H, NISHIDA E, et al. Dose effects of beta-tricalcium phosphate nanoparticles on biocompatibility and bone conductive ability of three-dimensional collagen scaffolds. Dental Materials Journal, 2017, 36(5):573. DOI PMID
[7]	FANG Z Z. Sintering of advanced materials. Cambridge: Elsevier, 2010: 33- 85.
[8]	KAUR I, ELLIS L J, ROMER I, et al. Dispersion of nanomaterials in aqueous media: towards protocol optimization. Journal of Visualized Experiments, 2017, 130: e56074.
[9]	XUE W, DAHLQUIST K, BANERJEE A, et al. Synthesis and characterization of tricalcium phosphate with Zn and Mg based dopants. Journal of Materials Science: Materials in Medicine, 2008, 19(7):2669. DOI URL
[10]	GUO X, LONG Y, LI W, et al. Osteogenic effects of magnesium substitution in nano-structured β-tricalcium phosphate produced by microwave synthesis. Journal of Materials Science, 2019, 54(16):11197. DOI
[11]	ELIAZ N, METOKI N J M. Calcium phosphate bioceramics: a review of their history, structure, properties, coating technologies and biomedical applications. Materials, 2017, 10(4):334. DOI URL
[12]	RAO R R, ROOPA H N, KANNAN T S. Solid state synthesis and thermal stability of HAP and HAP-β-TCP composite ceramic powders. Journal of Materials Science: Materials in Medicine, 1997, 8(8):511. DOI URL
[13]	RUIZ-AGUILAR C, OLIVARES-PINTO U, AGUILAR-REYES E A, et al. Characterization of β-tricalcium phosphate powders synthesized by Sol-Gel and mechanosynthesis. Boletín de la Sociedad Española de Cerámica y Vidrio, 2018, 57(5):213. DOI URL
[14]	ANDO J. Tricalcium phosphate and its variation. Bulletin of the Chemical Society of Japan, 1958, 31(2):196. DOI URL
[15]	OLSSON M. Chemical stability of grain boundariesinβ-tricalcium phosphate ceramics: β-TCP as bone substitute material. Department of Chemistry-Ångström, 2012, 42586904.
[16]	SGLAVO VM, FRASNELLI M. Effect of Mg²⁺ doping on beta- alpha phase transition in tricalcium phosphate (TCP) bioceramics. Acta Biomaterialia, 2016, 33: 283.
[17]	MA Y, DAI H, HUANG X, et al. 3D printing of bioglass-reinforced β-TCP porous bioceramic scaffolds. Journal of Materials Science, 2019, 54(14):10437. DOI
[18]	GALLO M, SANTONI B L G, DOUILLARD T, et al. Effect of grain orientation and magnesium doping on β-tricalcium phosphate resorption behavior. Acta Biomaterialia, 2019, 89: 391.
[19]	TAVARES D D S, CASTRO L D O, SOARES G D D A, et al. Synthesis and cytotoxicity evaluation of granular magnesium substituted β-tricalcium phosphate. Journal of Applied Oral Science, 2013, 21(1):37. DOI URL
[20]	LEE D, SFEIR C, KUMTA P N J M S, et al. Novel in-situ synthesis and characterization of nanostructured magnesium substituted β-tricalcium phosphate (β-TCMP). Materials Science, 2009, 29(1):69. DOI URL
[21]	MARCHI J, DANTAS A, GREIL P, et al. Influence of Mg-substitution on the physicochemical properties of calcium phosphate powders. Materials Research Bulletin, 2007, 42(6):1040. DOI URL
[22]	RYU H-S, HONG KS, LEE J-K, et al. Magnesia-doped HA/β-TCP ceramics and evaluation of their biocompatibility. Biomaterials, 2004, 25(3):393. DOI URL
[23]	ZHANG X, JIANG F, GROTH T, et al. Preparation, characterization and mechanical performance of dense β-TCP ceramics with/ without magnesium substitution. Journal of Materials Science: Materials in Medicine, 2008, 19(9):3063. DOI URL
[24]	ONUMA K, IIJIMA M J C. Nanoparticles in β-tricalcium phosphate substrate enhance modulation of structure and composition of an octacalcium phosphate grown layer. CrystEngComm, 2017, 19(44):6660. DOI URL
[25]	SADER M S, LEGEROS R Z, SOARES G A. Human osteoblasts adhesion and proliferation on magnesium-substituted tricalcium phosphate dense tablets. Journal of Materials Science: Materials in Medicine, 2009, 20(2):521. DOI URL
[26]	LIN L C, CHANG S J, KUO S M, et al. Preparation and evaluation of β-TCP/polylactide microspheres as osteogenesis materials. Journal of Applied Polymer Science, 2008, 108(5):3210. DOI URL
[27]	YUAN Z, WEI P, HUANG Y, et al. Injectable PLGA microspheres with tunable magnesium ion release for promoting bone regeneration. Acta Biomaterialia. 2019, 85: 294.
[28]	WANG J, XU J, HOPKINS C, et al. Biodegradable magnesium ased implants in orthopedics: a general review and perspectives. Advanced Science, 2020, 7(8):201902443.
[29]	LIN S, YANG G, JIANG F, et al. Bone regeneration: a magnesiumnriched 3D culture system that mimics the bone development microenvironment for vascularized bone regeneration. Advanced Science, 2019, 6(12):1900209. DOI URL
[30]	PAN C, SUN X, XU G, et al. The effects of β-TCP on mechanical properties, corrosion behavior and biocompatibility of beta- TCP/Zn-Mg composites. Materials Science & Engineering C, 2020, 108: 110397.
[31]	ZHANG H, SHEN Y, XIONG Y, et al. Microstructural, mechanical properties and strengthening mechanism of DLP produced β-tricalcium phosphate scaffolds by incorporation of MgO/ZnO/58S bioglass. Ceramics International, 2021, 47(18):25863. DOI URL
[32]	ZHANG J. TANG L, QI H, et al. Dual function of magnesium in bone biomineralization, Advanced Healthcare Materials, 2019, 8(21):1901030. DOI URL
[33]	LIN X, GE J, WEI D, et al. Surface degradation-enabled osseointegrative, angiogenic and antiinfective properties of magnesium- modified acrylic bone cement. Journal of Orthopaedic Translation. 2019, 17: 121.
[34]	HE F, TIAN Y, FANG X, et al. Porous calcium phosphate composite bioceramic beads. Ceramics International, 2018, 44(11):13430. DOI URL
[35]	HO V H, TRIPATHI G, GWON J, et al. Novel TOCNF reinforced injectable alginate/β-tricalcium phosphate microspheres for bone regeneration. Materials & Design, 2020, 194: 108892.
[36]	MURAKAMI M, NGUYEN L T, HATANAKA K, et al. FGF-dependent regulation of VEGF receptor 2 expression in mice. The Journal of Clinical Investigation, 2011, 121(7):2668. DOI URL
[37]	OLIVARES-NAVARRETE R, HYZY S L, GITTENS R A, et al. Rough titanium alloys regulate osteoblast production of angiogenic factors. The Spine Journal, 2013, 13(11):1563. DOI URL
[38]	MATKAR P N, ARIYAGUNARAJAH R, LEONG-POI H, et al. Friends turned foes: angiogenic growth factors beyond angiogenesis. Biomolecules, 2017, 7(4):74. DOI URL
[39]	CHIM S M, TICKNER J, CHOW S T, et al. Angiogenic factors in bone local environment. Cytokine Growth Factor Reviews, 2013, 24(3):297. DOI URL
[40]	TAN A W, LIAU L L, CHUA K H, et al. Enhanced in vitro angiogenic behaviour of human umbilical vein endothelial cells on thermally oxidized TiO₂ nanofibrous surfaces. Scientific Reports, 2016, 6(1):21828 DOI
[41]	PRZYBYLSKI M. A review of the current research on the role of bFGF and VEGF in angiogenesis. Journal of Wound Care, 2009, 18(12):516. PMID
[42]	CHEN Y, OU Y, DONG J, et al. Osteopontin promotes collagen I synthesis in hepatic stellate cells by miRNA-129-5p inhibition. Experimental Cell Research, 2017, 363(1):343.
[43]	BHASKAR B, OWEN R, BAHMAEE H, et al. Composite porous scaffold of PEG/PLA support improved bone matrix deposition in vitro compared to PLA-only scaffolds, Journal of Biomedical Research Part A, 2018, 106(5):1334.